Biologia

A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada.

3’ ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’

Anita S.
Anita
perguntou há 1 semana

Sabe a resposta?

Ganhe 10 pts por resposta de qualidade
Responder dúvida
1 resposta
0
votos
Nenhum usuário votou nessa resposta como útil.
Professora Lidiane G.
Respondeu há 1 semana

Olá Anita, é só seguirmos o código genético. (https://www.blogdovestibular.com/wp-content/uploads/2019/11/Questao-codigo-genetico-UFRGS-2012.png)

Assim a fita de DNA codificante seria:

 

5’ TGA CAA AAT GAC AAA GGG GTT TAA TTT CTA AAA T 3'

 

uma possível sequência de RNA mensageiro seria:

 

UGA CAA AAU GAC AAA GGG GUU UAA UUU CUA AAA

 

Em consequência provável sequência de aminoácidos codificada.

 

Fim-Gin-Ans-Asp-Lis-Gli-Val-Fim-Fen-Leu-Lis

 

Espero que tenha ajudado e estou à disposição

Professores particulares de Veterinária

+ Ver todos
Encontre e contrate um professor particular para te ajudar nos estudos.
Linhares / ES
Especialização: Docência em Matemática e Práticas Pedagógicas (Universidade Cândido Mendes)
Veterinária - Orientação Veterinária - revisão e formatação de TCC Melhoramento Genético Animal Genética Veterinária Veterinária - Bioestatística
Doutorado na área de Estatística. Ótimo trabalho com aulas preparatórias para concursos, inclusive Raciocínio Lógico. Reforço de Matemática, E. Médio.
Oferece aulas online (sala profes)
R$ 60 / aula
Conversar Whatsapp do professor Lidiane G. Whatsapp do professor Lidiane G. Ver WhatsApp
1ª aula demonstrativa
Responde em 1 h e 59 min
2 avaliações
Contagem / MG
Doutorado: Ciências Farmacêuticas (UFMG)
Veterinária - Biologia Molecular Veterinária - Ensino Fundamental Veterinária - Bioquímica celular Exercícios de Veterinária Veterinária Básica Curso superior em Veterinária Veterinária Pré-Vestibular
Leciono Ciências e Biologia para os ensinos Fundamental e Médio. Também tenho experiência com as disciplinas introdutórias da Graduação.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Maria F. Whatsapp do professor Maria F. Ver WhatsApp
1ª aula demonstrativa
Responde em 2 h e 52 min
13 avaliações
São Carlos / SP
Doutorado: Doutoranda em Biotecnologia (Universidade Federal de São Carlos)
Veterinária - Biologia Celular Imunologia Veterinária Patologia Animal Veterinária - Microbiologia Veterinária - Biologia Veterinária - Processos Biológicos Melhoramento Genético Animal
Venha aprender Biologia, Farmácia-Bioquímica, Enfermagem
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Taís T. Whatsapp do professor Taís T. Ver WhatsApp
1ª aula demonstrativa
Responde em 6 h e 1 min

Pergunte aos nossos professores

Você possui uma lista de exercícios ou Trabalho?

Se seu problema for dificuldade em uma lista de exercícios, revisão de teses e dissertações, correção de textos ou outros trabalhos, peça uma ajuda pelo Tarefas Profes.

Enviar Tarefa