Aulas particulares de Curso superior em Veterinária

No Profes você encontra 28 professores particulares de Curso superior em Veterinária

Se seu problema for dificuldade em uma lista de exercícios, revisão de teses e dissertações, correção de textos ou outros trabalhos, peça uma ajuda pelo Tarefas Profes.

Enviar Tarefa
28 professores
2 avaliações
Contagem / MG
Doutorado: Ciências Farmacêuticas (UFMG)
Veterinária - Biologia Molecular Veterinária - Ensino Fundamental Veterinária - Bioquímica celular Exercícios de Veterinária Veterinária Básica Curso superior em Veterinária Veterinária Pré-Vestibular
Leciono Ciências e Biologia para os ensinos Fundamental e Médio. Também tenho experiência com as disciplinas introdutórias da Graduação.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Maria F. Whatsapp do professor Maria F. Ver WhatsApp
1ª aula demonstrativa
Responde em 2 h e 51 min
Belo Horizonte / MG
Veterinária - Bioquímica Veterinária - formatação Anatomia Veterinária Veterinária - trabalhos Curso superior em Veterinária
Professora de Engenharia, Cálculo, Física e Química com anos de experiência no ensino Superior.
Oferece aulas online (sala profes)
R$ 40 / aula
1ª aula demonstrativa
Responde em 59 min
Satisfação garantida
Contrate seu professor de forma segura pelo profes
Sabemos que o início de aulas com um novo professor é um grande passo e queremos que você se sinta confiante na contratação.

Por isso, caso você tenha problemas com o professor escolhido, o valor investido é retido e teremos todo o prazer em ajudá-lo a encontrar um novo professor.

Caso você opte por ter seu dinheiro de volta, devolvemos o valor investido, subtraindo apenas a Taxa de Serviço (12%).
São Paulo / SP
Especialização: Especialização em Educação com Ênfase em Docência em EAD (IFSP - Instituto Federal de São Paulo)
Nutrição Animal Veterinária em Geral Veterinária - Biologia Celular Imunologia Veterinária Citologia Veterinária Patologia Animal Parasitologia Animal
Aulas de Biologia, Redação, Veterinária
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 65 / aula
Conversar Whatsapp do professor Simone B. Whatsapp do professor Simone B. Ver WhatsApp
Responde em 1 h e 10 min
Ribeirão Pires / SP
Fisiologia Veterinária Patologia Veterinária Veterinária - Microbiologia Curso superior em Veterinária Citologia Veterinária Anatomia Veterinária Veterinária - Imunologia Básica
Medicina Veterinária: Disciplinas pré-curriculares; Plantão de dúvidas; Bioquímica; Anatomia; Histologia; Fisiologia; Imunologia; Patologia
Oferece aulas online (sala profes)
R$ 50 / aula
Conversar Whatsapp do professor Lia S. Whatsapp do professor Lia S. Ver WhatsApp
1ª aula demonstrativa
Responde em 13 h e 42 min
Rio de Janeiro / RJ
Fisiologia Veterinária Certificação em Veterinária Ajuda em Veterinária Problemas em Veterinária Virologia Veterinária Certificações em Veterinária Concurso para Veterinária
Estude Inglês, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 100 / aula
Conversar Whatsapp do professor Thiago S. Whatsapp do professor Thiago S. Ver WhatsApp
São Paulo / SP
Doutorado: Microbiologia e Imunologia (UNIFESP - Universidade Federal de São Paulo)
Veterinária - Biologia Molecular Veterinária - Biologia Celular Imunologia Veterinária Certificação em Veterinária Genética Veterinária Ajuda em Veterinária Problemas em Veterinária
Vendo aulas de Química, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Natanael P. Whatsapp do professor Natanael P. Ver WhatsApp
1ª aula demonstrativa
Piracicaba / SP
Pós Doutorado: Bioquímica de plantas (Universidade de São Paulo)
Certificação em Veterinária Ajuda em Veterinária Veterinária - Bioquímica Problemas em Veterinária Veterinária para Fuvest Concurso para Veterinária Veterinária Online
Faça aula de Biologia, Farmácia-Bioquímica, Enfermagem
Oferece aulas online (sala profes)
R$ 100 / aula
Conversar Whatsapp do professor Juliano G. Whatsapp do professor Juliano G. Ver WhatsApp
Natal / RN
Doutorado: Farmácia e Bioquímica (Universidade de São Paulo)
Imunologia Veterinária Certificação em Veterinária Ajuda em Veterinária Veterinária - Bioquímica Problemas em Veterinária Veterinária para o ENEM Veterinária Avançada
Vendo aulas de Química, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 60 / aula
Conversar Whatsapp do professor Marco V. Whatsapp do professor Marco V. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Graduação: Medicina Veterinária (fmvz-usp)
Veterinária - Biologia Celular Imunologia Veterinária Certificação em Veterinária Ajuda em Veterinária Problemas em Veterinária Veterinária - Molecular Certificações em Veterinária
Aprenda Matemática, Inglês, Fisioterapia
Oferece aulas online (sala profes)
R$ 40 / aula
Conversar Whatsapp do professor Beatriz A. Whatsapp do professor Beatriz A. Ver WhatsApp
Campinas / SP
Graduação: Licenciatura em Química (UNICAMP)
Animal Nível Superior Veterinária para Fuvest Dúvida em Veterinária Veterinária Básica Introdução à Veterinária Curso superior em Veterinária Veterinária Pré-Vestibular
Estude comigo Química, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 90 / aula
Conversar Whatsapp do professor Carolina L. Whatsapp do professor Carolina L. Ver WhatsApp
São Paulo / SP
Doutorado: Bacharelado em Ciências Biológicas (Faculdade de Medicina da USP)
Veterinária - Biologia Molecular Veterinária - Biologia Celular Veterinária - Ensino Médio Técnico em Veterinária Vestibular de Veterinária Veterinária - Bioquímica Curso superior em Veterinária
Professor de Biologia, Farmácia-Bioquímica, Enfermagem
Oferece aulas online (sala profes)
R$ 60 / aula
Conversar Whatsapp do professor Karolline S. Whatsapp do professor Karolline S. Ver WhatsApp
Santo André / SP
Mestrado: Bioquímica (Universidade Federal de São Paulo)
Certificação em Veterinária Ajuda em Veterinária Problemas em Veterinária Veterinária para Fuvest Concurso para Veterinária Veterinária Online Exercícios de Veterinária
Professora de Bioquímica com 15 anos de experiência no ensino superior. Graduação e Mestrado pela UNIFESP
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 60 / aula
Conversar Whatsapp do professor Eliza P. Whatsapp do professor Eliza P. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Mestrado: Comportamento e Biologia Animal (UNESP - Universidade Estadual Paulista)
Veterinária - Ensino Fundamental Graduação Veterinária Curso superior em Veterinária Veterinária - Biologia geral Veterinária - Biologia Celular Veterinária - Zoologia Orientação, revisão e formatação de TCC em Veterinária
Faça aula de Biologia, Enfermagem, Nutrição
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Silara F. Whatsapp do professor Silara F. Ver WhatsApp
1ª aula demonstrativa
Florianópolis / SC
Especialização: Vigilância em Saúde (Hospital Sírio-Libanês)
Curso superior em Veterinária Veterinária - Epidemiologia Saúde Pública Veterinária Concurso para Veterinária Veterinária - Bioestatística Vigilância em Saúde Veterinária Profissional
Ofereço aulas de Biologia, Estatística, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 70 / aula
Conversar Whatsapp do professor Maria C. Whatsapp do professor Maria C. Ver WhatsApp
1ª aula demonstrativa
Niterói / RJ
Doutorado: Medicina Veterinária (Universidade Federal Fluminene (UFF))
Veterinária - Biofísica Problemas em Veterinária Veterinária - Química Veterinária em Geral Veterinária - Biologia Celular Imunologia Veterinária Citologia Veterinária
Dou aulas de Biologia, Desenho, Nutrição
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Paloma R. Whatsapp do professor Paloma R. Ver WhatsApp
Rio de Janeiro / RJ
Doutorado: Ciência Tecnologia e Educação (CEFET-RJ)
Dúvida em Veterinária Veterinária Básica Curso superior em Veterinária Veterinária - Biofísica Veterinária no Ensino Superior Vestibular de Veterinária Veterinária - Orientação
Venha estudar Biologia, História, Pedagogia
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 55 / aula
Conversar Whatsapp do professor Luciana F. Whatsapp do professor Luciana F. Ver WhatsApp
1ª aula demonstrativa
Santos / SP
Doutorado: Ciências Biológicas/Zoologia (Universidade Estadual Paulista UNESP)
Técnico em Veterinária Concurso para Veterinária Vestibular de Veterinária Veterinária - Ensino Fundamental Bem-Estar Animal Curso superior em Veterinária Veterinária - Ensino Médio
Ensino Matemática, Física, Biologia
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 90 / aula
Conversar Whatsapp do professor Renata R. Whatsapp do professor Renata R. Ver WhatsApp
1ª aula demonstrativa
Itajubá / MG
Veterinária - Biofísica Veterinária - Biologia Molecular Veterinária - Biologia Celular Imunologia Veterinária Citologia Veterinária Certificação em Veterinária Patologia Animal
Professor de Biologia, Veterinária
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 45 / aula
Conversar Whatsapp do professor Adriano C. Whatsapp do professor Adriano C. Ver WhatsApp
1ª aula demonstrativa
Fortaleza / CE
Veterinária - Ensino Fundamental Curso superior em Veterinária Veterinária - Bioquímica Humana Vestibular de Veterinária Concurso para Veterinária Veterinária - Farmacologia Veterinária - Ensino Médio
Aulas comigo de Biologia, Farmácia-Bioquímica, Medicina
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Ana T. Whatsapp do professor Ana T. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Veterinária - Biologia Molecular Veterinária - Biologia Celular Genética Veterinária Fisiologia Veterinária Anatomia Veterinária Técnico em Veterinária Veterinária - Processos Biológicos
Faça aulas de Biologia, Farmácia-Bioquímica, Enfermagem
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 70 / aula
Conversar Whatsapp do professor Jaqueline G. Whatsapp do professor Jaqueline G. Ver WhatsApp
1ª aula demonstrativa
Ribeirão Preto / SP
Veterinária - Biofísica Veterinária Intermediário Citologia Veterinária Certificação em Veterinária Ajuda em Veterinária Problemas em Veterinária Veterinária para o ENEM
Aulas de Matemática, Física, Biologia
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Jéssica A. Whatsapp do professor Jéssica A. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Todas as Disciplinas da Veterinária 3º ano Veterinária em Geral Curso superior em Veterinária Vestibular de Veterinária Veterinária - 2º ano Tudo de Veterinária
Faça aula de Inglês, Biologia, História
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Stephanie V. Whatsapp do professor Stephanie V. Ver WhatsApp
1ª aula demonstrativa
Itapeva / SP
Fisiologia Veterinária Curso superior em Veterinária Veterinária Profissional Veterinária - Bioquímica
Faça aula de Biologia, Farmácia-Bioquímica, Fisioterapia
Oferece aulas online (sala profes)
R$ 70 / aula
Conversar Whatsapp do professor Paula L. Whatsapp do professor Paula L. Ver WhatsApp
1ª aula demonstrativa
Rio de Janeiro / RJ
Veterinária - Bioquímica animal Veterinária - Biologia Celular Citologia Veterinária Veterinária - Medicina Veterinária Clínica Médica de Pequenos Animais Semiologia Veterinária Exercícios de Veterinária
Estudante e monitora de Medicina Veterinária do 8° Período. Ensino matérias básicas e específicas.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Sullamita L. Whatsapp do professor Sullamita L. Ver WhatsApp
1ª aula demonstrativa
Botucatu / SP
Tudo de Veterinária Curso superior em Veterinária Veterinária - Ensino Médio Vestibular de Veterinária Anatomia Veterinária Técnico em Veterinária Veterinária - Ensino Fundamental
Aprenda comigo Veterinária
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Isabella G. Whatsapp do professor Isabella G. Ver WhatsApp
1ª aula demonstrativa
Rio de Janeiro / RJ
Graduação: Medicina Veterinária (UFF - Universidade Federal Fluminense)
Vestibular de Veterinária Veterinária - Ensino Médio Veterinária - Ensino Fundamental Curso superior em Veterinária
Professor de Física, Química, Biologia
Oferece aulas presenciais
R$ 80 / aula
Conversar Whatsapp do professor Rebeca F. Whatsapp do professor Rebeca F. Ver WhatsApp
São Bernardo do Campo / SP
Especialização: Expecialização em Fisiologia (FMABC)
Orientação de TCC em Veterinária Ornitopatologia Parasitologia Animal Medicina Veterinária Preventiva Veterinária - Biologia Molecular Animais Silvestres 3º ano
Ofereço aulas de Matemática, Química, Biologia
Oferece aulas presenciais
R$ 60 / aula
Conversar Whatsapp do professor Bruna B. Whatsapp do professor Bruna B. Ver WhatsApp
Fortaleza / CE
Doutorado: Doutorado em Bioquímca (Universidade Federal do Ceará - UFC)
Veterinária - Biologia Molecular Veterinária - Biologia Celular Imunologia Veterinária Certificação em Veterinária Ajuda em Veterinária Problemas em Veterinária Veterinária para o ENEM
Venha aprender Biologia, Enfermagem, Educação Física
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Pedro F. Whatsapp do professor Pedro F. Ver WhatsApp
Curso superior X
Outras especialidades de Veterinária
Professores ativos agora
Deixe o profes te sugerir os melhores professores
Encontrar professores

Aulas particulares de Curso superior em Veterinária

Uma das formas mais inteligentes de solidificar conceitos ou aprender algo novo em Curso superior em Veterinária (mas poderia ser outras especialidades dentro do tema Veterinária como Patologia Geral, Reprodução Animal ou mesmo Reprodução Animal), é por meio de uma aula profes, dada na sua velocidade pelos professores mais habilitados do Brasil.

O profes, a melhor e maior plaforma de professores particulares do Brasil, constata que ter um superprof, aquele tutor exato, destacado no seu meio, seja online - a distância ou no local de sua escolha, é o formato pedagógico mais incrível para passar de ano, aprender algo novo ou mesmo reforçar um conceito já aprendido. Nós colocamos a sua frente um professor de forma rápida para aulas online, na nossa sala profes, desenvolvida para um aprendizado preciso ou, caso preferir, em aulas presenciais.

Nós apresentamos professores em todos os niveis de Curso superior em Veterinária, desde o mais básico, passando pelo intermediário, avançado até o profissional, também para alunos do Ensino Fundamental, Ensino Médio ou Ensino Superior. Além de universitários, aqui você encontra professores com bacharelado, licenciatura, mestrado, doutorado ou profissionais a sua disposição. Agora, se você é uma pessoa animada, quer aprender algo diferente, saiba também que temos profissionais em todas especialidades, como marketing de serviços, na área de Marketing, Introdução à Programação com Java, na área de Computação ou Técnicas de apresentação, na área de Comunicação. Está interessado em ter aulas e novos aprendizados? Entre em contato conosco. Boas aulas!

Aulas de Curso superior em Veterinária em casa

Sabemos que às vezes o a aula presencial pode ser muito efetiva. É por isso que no profes você pode realizar aulas de curso superior em veterinária particular à domicílio.

Busque filtrando por sua cidade, ou até mesmo na sua casa, encontrando os professores mais próximos de você!

Aulas de Curso superior em Veterinária online

Para você que não quer perder tempo ou busca preços mais acessíveis, o profes oferece um serviço de aulas particulares online .

Nossas aulas online acontecem na sala profes, uma sala virtual exclusiva com vídeo-conferência e todas as ferramentas para suas aulas serem perfeitas!

Com o tira-dúvidas do Profes você pode enviar uma dúvida por mês gratuitamente. Migre de plano para enviar dúvidas ilimitadas. Nossos professores particulares estão aqui para te ajudar.

Biologia (genética)
A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada.                3’ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’...
Cleo S. Cleo S. perguntou há 2 dias
1 resposta
A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada. 3’ ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’...
Anita S. Anita S. perguntou há 3 dias
1 resposta

Pergunte aos nossos professores

Me ajudem
file:///C:/Users/Marcelo/Downloads/exercicio.pdf me ajuda nesses exercícios...
Rodrigo S. Rodrigo S. perguntou há 3 dias
1 resposta
A partir da sequência de aminoácidos abaixo, demonstre uma possível sequência de DNA (fita dupla) indicando a fita molde e o sentido de ambas as fitas.  Met-Ala-Asp-Met-His-Fen-Arg-Asn-Ser-Gli...
Gabriela S. Gabriela S. perguntou há 4 dias
1 resposta
Proteina queratina
quantos aminoacidos a queratina tem e quantos nitrogenios hidrogenios carbonos e etc ela tem...
Eliana P. Eliana P. perguntou há 6 meses
1 resposta

Professor particular de Curso superior em Veterinária

Quer aprender Curso superior em Veterinária? No Profes você encontra o professor de curso superior em veterinária particular perfeito para que você aprenda eficientemente, por meio de aulas ou até mesmo um curso online de curso superior em veterinária.

Você é professor? No Profes você pode oferecer suas aulas, criando o seu perfil gratuitamente! Crie seu perfil de professor particular

Aulas de Reforço Escolar de Curso superior em Veterinária

Se você está na escola, na faculdade, ou fazendo qualquer tipo de curso, o Profes oferece aulas de reforço escolar de curso superior em veterinária particular, para você alcançar todos os seus objetivos acadêmicos!

Aqui você encontra Reforço Escolar para todos os níveis e necessidades: Ensino Fundamental, Ensino Médio, Ensino Superior e cursos livres.