Aulas particulares de Veterinária

No Profes você encontra 96 professores particulares de Veterinária

Se seu problema for dificuldade em uma lista de exercícios, revisão de teses e dissertações, correção de textos ou outros trabalhos, peça uma ajuda pelo Tarefas Profes.

Enviar Tarefa
96 professores
2 avaliações
Contagem / MG
Doutorado: Ciências Farmacêuticas (UFMG)
Veterinária - Biologia Molecular Veterinária - Ensino Fundamental Veterinária - Bioquímica celular Exercícios de Veterinária Veterinária Básica Curso superior em Veterinária Veterinária Pré-Vestibular
Leciono Ciências e Biologia para os ensinos Fundamental e Médio. Também tenho experiência com as disciplinas introdutórias da Graduação.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Maria F. Whatsapp do professor Maria F. Ver WhatsApp
1ª aula demonstrativa
Responde em 2 h e 51 min
13 avaliações
São Carlos / SP
Doutorado: Doutoranda em Biotecnologia (Universidade Federal de São Carlos)
Veterinária - Biologia Celular Imunologia Veterinária Patologia Animal Veterinária - Microbiologia Veterinária - Biologia Veterinária - Processos Biológicos Melhoramento Genético Animal
Venha aprender Biologia, Farmácia-Bioquímica, Enfermagem
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Taís T. Whatsapp do professor Taís T. Ver WhatsApp
1ª aula demonstrativa
Responde em 6 h e 3 min
Satisfação garantida
Contrate seu professor de forma segura pelo profes
Sabemos que o início de aulas com um novo professor é um grande passo e queremos que você se sinta confiante na contratação.

Por isso, caso você tenha problemas com o professor escolhido, o valor investido é retido e teremos todo o prazer em ajudá-lo a encontrar um novo professor.

Caso você opte por ter seu dinheiro de volta, devolvemos o valor investido, subtraindo apenas a Taxa de Serviço (12%).
Linhares / ES
Especialização: Docência em Matemática e Práticas Pedagógicas (Universidade Cândido Mendes)
Veterinária - Orientação Veterinária - revisão e formatação de TCC Melhoramento Genético Animal Genética Veterinária Veterinária - Bioestatística
Doutorado na área de Estatística. Ótimo trabalho com aulas preparatórias para concursos, inclusive Raciocínio Lógico. Reforço de Matemática, E. Médio.
Oferece aulas online (sala profes)
R$ 60 / aula
Conversar Whatsapp do professor Lidiane G. Whatsapp do professor Lidiane G. Ver WhatsApp
1ª aula demonstrativa
Responde em 1 h e 54 min
Vitória / ES
Doutorado: Biotecnologia (UFES - Universidade Federal do Espirito Santo)
Patologia Geral em Veterinária Veterinária - Biologia Celular Citologia Veterinária Parasitologia Veterinária Veterinária - Microbiologia Genética Veterinária Veterinária - biotecnologia
Professor de Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Camila B. Whatsapp do professor Camila B. Ver WhatsApp
1ª aula demonstrativa
Responde em 3 h e 33 min
Belo Horizonte / MG
Veterinária - Bioquímica Veterinária - formatação Anatomia Veterinária Veterinária - trabalhos Curso superior em Veterinária
Professora de Engenharia, Cálculo, Física e Química com anos de experiência no ensino Superior.
Oferece aulas online (sala profes)
R$ 40 / aula
Conversar
1ª aula demonstrativa
Responde em 340 dias e 17 h
4 avaliações
Curitiba / PR
Doutorado: Farmácia e Bioquímica (UFPR - Universidade Fedral do Paraná)
Veterinária - Orientação Citologia Veterinária Veterinária - revisão e formatação de TCC Veterinária - Imunologia Básica Veterinária - Farmacologia Veterinária - Bioquímica celular Veterinária - Bioquímica animal
Aprenda Biologia, Farmácia-Bioquímica, Medicina
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 70 / aula
Conversar Whatsapp do professor Silvia P. Whatsapp do professor Silvia P. Ver WhatsApp
Responde em 10 h e 18 min
1 avaliação
Medianeira / PR
Doutorado: Ecologia de Ambientes Aquáticos Continentais (Universidade Estadual de Maringá (UEM))
Veterinária - Biologia Celular Veterinária - Zoologia Fisiologia Animal Comparada Veterinária - Microbiologia
Professora de Biologia, com experiência no Ensino superior e básico. Venha aprender de verdade de forma leve e divertida
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Priscilla G. Whatsapp do professor Priscilla G. Ver WhatsApp
1ª aula demonstrativa
Responde em 2 dias e 11 h
Rio de Janeiro / RJ
Mestrado: Ciências e Biotecnologia (UFF - Universidade Federal Fluminense)
Ajuda em Veterinária Veterinária - Ensino Fundamental Vestibular de Veterinária Anatomia Veterinária Veterinária - Ensino Médio
Aprenda Biologia, Farmácia-Bioquímica, Medicina
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Luiz F. Whatsapp do professor Luiz F. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Especialização: Especialização em Educação com Ênfase em Docência em EAD (IFSP - Instituto Federal de São Paulo)
Nutrição Animal Veterinária em Geral Veterinária - Biologia Celular Imunologia Veterinária Citologia Veterinária Patologia Animal Parasitologia Animal
Aulas de Biologia, Redação, Veterinária
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 65 / aula
Conversar Whatsapp do professor Simone B. Whatsapp do professor Simone B. Ver WhatsApp
Responde em 1 h e 10 min
Maringá / PR
Veterinária - Biologia Celular Veterinária Pré-Vestibular Veterinária - Bioquímica
Professora de biologia com experiência em ENEM, vestibulares e concursos públicos.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 45 / aula
Conversar Whatsapp do professor Laryssa H. Whatsapp do professor Laryssa H. Ver WhatsApp
1ª aula demonstrativa
Responde em 2 h e 13 min
Fortaleza / CE
Doutorado: Ciências Médicas (Universidade Federal do Ceará - UFC)
Veterinária - Biologia Celular Veterinária - Biologia Molecular Fisiologia Veterinária Veterinária - Bioestatística Veterinária - Revisão Veterinária - Histologia Formatação de TCC em Veterinária
Venha estudar Biologia, Medicina, Enfermagem
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Fernando H. Whatsapp do professor Fernando H. Ver WhatsApp
1ª aula demonstrativa
Campo Grande / MS
Especialização: Neurociências (puc-rs)
Veterinária - Biologia Celular Veterinária - Microbiologia Anatomia Veterinária
Tutor/Professor neurocientista e apaixonado pelo conhecimento com técnicas poderosas para você aprender!
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 100 / aula
Conversar Whatsapp do professor Johnny S. Whatsapp do professor Johnny S. Ver WhatsApp
1ª aula demonstrativa
Manaus / AM
Doutorado: Genética, Conservação e Biologia Evolutiva ( Instituo Nacional de Pesquisas da Amazônia - INPA)
Veterinária - Orientação Formatação de TCC em Veterinária Melhoramento Genético Animal Veterinária - Biologia Molecular Genética Veterinária Orientação de TCC em Veterinária Veterinária - Biologia geral
Ensino Matemática, Química, Biologia
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 60 / aula
Conversar Whatsapp do professor Fábio M. Whatsapp do professor Fábio M. Ver WhatsApp
1ª aula demonstrativa
Responde em 11 h e 19 min
Ribeirão Pires / SP
Fisiologia Veterinária Patologia Veterinária Veterinária - Microbiologia Curso superior em Veterinária Citologia Veterinária Anatomia Veterinária Veterinária - Imunologia Básica
Medicina Veterinária: Disciplinas pré-curriculares; Plantão de dúvidas; Bioquímica; Anatomia; Histologia; Fisiologia; Imunologia; Patologia
Oferece aulas online (sala profes)
R$ 50 / aula
Conversar Whatsapp do professor Lia S. Whatsapp do professor Lia S. Ver WhatsApp
1ª aula demonstrativa
Responde em 13 h e 42 min
5 avaliações
São Carlos / SP
Doutorado: Doutorado em Biotecnologia (Universidade Federal de São Carlos)
Veterinária - Imunologia Básica Veterinária - Biologia Molecular Melhoramento Genético Animal Veterinária - Biologia Celular Imunologia Veterinária Patologia Animal Veterinária - Microbiologia
Aulas comigo de Química, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor André A. Whatsapp do professor André A. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Doutorado: Farmacologia (UNIFESP - Universidade Federal de São Paulo)
Veterinária - Biologia Celular Veterinária - Bioquímica Fisiologia Animal Comparada Citologia Veterinária
Aulas de Biologia, Farmácia-Bioquímica, Medicina
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 55 / aula
Conversar Whatsapp do professor Debora G. Whatsapp do professor Debora G. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Graduação: Medicina Veterinária (Universidade Anhembi Morumbi)
Osteologia Veterinária Micro Ostelogia Veterinária Macro
Ofereço aulas de Biologia, Veterinária
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 45 / aula
Conversar Whatsapp do professor Gabriela G. Whatsapp do professor Gabriela G. Ver WhatsApp
1ª aula demonstrativa
Serra / ES
Graduação: Medicina Veterinária (UNIVERSIDADE FEDERAL RURAL DO RIO DE JANEIRO (UFRRJ))
Veterinária Profissional
Dou aulas de Veterinária
Oferece aulas online (sala profes)
R$ 50 / aula
Conversar Whatsapp do professor Paulo N. Whatsapp do professor Paulo N. Ver WhatsApp
1ª aula demonstrativa
Taboão da Serra / SP
Graduação: Medicina Veterinária (Universidade Anhembi Morumbi)
Veterinária - Biologia Celular Fisiologia Veterinária Veterinária - Bioquímica Citologia Veterinária Genética Veterinária Veterinária - Microbiologia Veterinária Básica
Venha estudar Inglês, Biologia, Veterinária
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Beatriz R. Whatsapp do professor Beatriz R. Ver WhatsApp
1ª aula demonstrativa
Rio de Janeiro / RJ
Fisiologia Veterinária Certificação em Veterinária Ajuda em Veterinária Problemas em Veterinária Virologia Veterinária Certificações em Veterinária Concurso para Veterinária
Estude Inglês, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 100 / aula
Conversar Whatsapp do professor Thiago S. Whatsapp do professor Thiago S. Ver WhatsApp
Botucatu / SP
Genética Veterinária Veterinária - Biologia geral Veterinária - Farmacologia
Aprenda Inglês, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
R$ 55 / aula
Conversar Whatsapp do professor Luciana F. Whatsapp do professor Luciana F. Ver WhatsApp
Cariacica / ES
Veterinária - Biologia Celular Citologia Veterinária Fisiologia Veterinária Veterinária - Microbiologia Anatomia Veterinária Veterinária - Bioquímica
Profissional a 17 anos no mercado com alto conhecimento na área biomédicas. Aulas dinâmicas com excelente material didático.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 70 / aula
Conversar Whatsapp do professor Fernando G. Whatsapp do professor Fernando G. Ver WhatsApp
1ª aula demonstrativa
1 avaliação
Santa Maria / RS
Mestrado: ANESTESIOLOGIA VETERINÁRIA (Universidade Federal de Santa Maria (UFSM))
Veterinária - Terapêutica veterinária Veterinária - Anestesiologia Veterinária Veterinária - UTI Veterinária - Anestesia local Veterinária - Controle da dor Clínica Médica de Pequenos Animais Veterinária - Urgência e emergência
Médica Veterinária e mestranda em Anestesiologia. Disposta a auxiliar na compreensão dessa área de uma forma fácil e personalizada.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Charline V. Whatsapp do professor Charline V. Ver WhatsApp
1ª aula demonstrativa
Santo André / SP
Veterinária - Química Veterinária - Microbiologia Veterinária - Bioquímica celular Veterinária - Biologia Celular Imunologia Veterinária Veterinária - Ensino Médio Dúvida em Veterinária
Venha se livrar das dificuldades de aprendizado comigo que também sou estudante e posso ver as dificuldades com os mesmos olhos que os seus!
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 45 / aula
Conversar Whatsapp do professor Beatriz S. Whatsapp do professor Beatriz S. Ver WhatsApp
1ª aula demonstrativa
Natal / RN
Doutorado: Farmácia e Bioquímica (Universidade de São Paulo)
Imunologia Veterinária Certificação em Veterinária Ajuda em Veterinária Veterinária - Bioquímica Problemas em Veterinária Veterinária para o ENEM Veterinária Avançada
Vendo aulas de Química, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 60 / aula
Conversar Whatsapp do professor Marco V. Whatsapp do professor Marco V. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Doutorado: Microbiologia e Imunologia (UNIFESP - Universidade Federal de São Paulo)
Veterinária - Biologia Molecular Veterinária - Biologia Celular Imunologia Veterinária Certificação em Veterinária Genética Veterinária Ajuda em Veterinária Problemas em Veterinária
Vendo aulas de Química, Biologia, Farmácia-Bioquímica
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Natanael P. Whatsapp do professor Natanael P. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Mestrado: Medicina Veterinária (Universidade de São Paulo)
Veterinária em Geral Veterinária no Ensino Superior Veterinária Nível Superior
Dou aulas de Biologia, História, Português
Oferece aulas online (sala profes)
R$ 70 / aula
Conversar Whatsapp do professor Fernanda J. Whatsapp do professor Fernanda J. Ver WhatsApp
Rio de Janeiro / RJ
Mestrado: Biologia Celular e Molecular (Fiocruz - Fundação Oswaldo Cruz)
Veterinária - Biologia Molecular Veterinária - Biologia Celular Parasitologia Animal Parasitologia Veterinária Veterinária - Bioquímica Veterinária Profissional
Aulas comigo de Biologia, Farmácia-Bioquímica, Medicina
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 40 / aula
Conversar Whatsapp do professor Hanna S. Whatsapp do professor Hanna S. Ver WhatsApp
1ª aula demonstrativa
São Paulo / SP
Doutorado: Ciências (IMT-USP)
Parasitologia Animal Anatomia Animal
Estude comigo Biologia, História, Português
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 45 / aula
Conversar Whatsapp do professor Carolina L. Whatsapp do professor Carolina L. Ver WhatsApp
1ª aula demonstrativa
Fortaleza / CE
Doutorado: Doutorado em Zootecnia (Universidade Federal de Viçosa (UFV))
Nutrição Animal Veterinária - Introdução a fisiologia Veterinária - Biologia Celular Veterinária - revisão e formatação de TCC Fisiologia Veterinária Fisiologia da Reprodução Veterinária Veterinária - Fisiologia Geral
Professor dr. em Fisiologia e Reprodução Animal. Ofereço também Estatística Básica e Orientação em projetos de conclusão de curso, dissertação e tese.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 45 / aula
Conversar Whatsapp do professor Marco S. Whatsapp do professor Marco S. Ver WhatsApp
1ª aula demonstrativa




Especialidades:
Professores ativos agora
Atendimento
Ambos
Presencial
Online
Deixe o profes te sugerir os melhores professores
Encontrar professores

Aulas particulares de Veterinária

Para você que está buscando aulas de Veterinária, o Profes, o maior portal de professores particulares do Brasil, dispõe de um grande número dos professores mais preparados, não somente de Veterinária, como também, dentro da disciplina Veterinária, especialidades como Anatomia Animal, Fisiologia Veterinária, Introdução à Veterinária ou Parasitologia Veterinária.

Nós propiciamos um professor particular, um superprof exímio para te atender no segundo que você mais precisa. O professor de Veterinária assinalado te dará um ensino personalizado com tranquilidade fazendo você aprender com precisão, encaixando a metodologia de ensino ao seu modo e tempo. Nós sabemos que nem sempre é descomplicado desenvolver de maneira imediata, portanto peça quantas aulas precisar, sejam aulas presenciais -no local de sua escolha, ou aulas online na nossa sala profes, o local acertado para uma aula particular a distância de qualidade espetacular.

Nossos professores podem lecionar aulas de Veterinária
desde o nível mais básico, passando pelo intermediário, avançado até o mais profissional, também para o Ensino Fundamental, Ensino Médio ou Ensino Superior. Além de universitários, aqui você encontra professores com bacharelado, licenciatura, mestrado, doutorado ou profissionais, a sua disposição. Agora, se você é um cara curioso, quer desenvolver algo atual, saiba também que temos professores particulares de tudo mesmo, como Basquete para Crianças, na área de Basquete, Impress, na área de Informática Geral ou Literatura no 1º Ano, na área de Literatura. Está interessado em ter aulas e novos aprendizados? Entre em contato conosco. Boas aulas!

Aulas de Veterinária em casa

Sabemos que às vezes o a aula presencial pode ser muito efetiva. É por isso que no profes você pode realizar aulas de veterinária particular à domicílio.

Busque filtrando por sua cidade, ou até mesmo na sua casa, encontrando os professores mais próximos de você!

Aulas de Veterinária online

Para você que não quer perder tempo ou busca preços mais acessíveis, o profes oferece um serviço de aulas particulares online .

Nossas aulas online acontecem na sala profes, uma sala virtual exclusiva com vídeo-conferência e todas as ferramentas para suas aulas serem perfeitas!

Com o tira-dúvidas do Profes você pode enviar uma dúvida por mês gratuitamente. Migre de plano para enviar dúvidas ilimitadas. Nossos professores particulares estão aqui para te ajudar.

Dúvida em anatomia animal
preciso identificar as estruturas da vértebra torácia T14 e T15 de um equino SÓ A QUESTÃO 7 https://learn-us-east-1-prod-fleet01-xythos.s3.us-east-1.amazonaws.com/5d152e0e8981d/18327967?response-cont...
Gabriely S. Gabriely S. perguntou há 2 dias
0 respostas
Biologia (genética)
A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada.                3’ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’...
Cleo S. Cleo S. perguntou há 5 dias
1 resposta

Pergunte aos nossos professores

Biologia
A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada. 3’ ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’...
Anita S. Anita S. perguntou há 5 dias
1 resposta
Me ajuda
A partir da sequência da fita codificante de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada. 5’ TTTATGAAGTGTTATTGATCGATA 3’...
Mel L. Mel L. perguntou há 5 dias
1 resposta
Me ajudem
file:///C:/Users/Marcelo/Downloads/exercicio.pdf me ajuda nesses exercícios...
Rodrigo S. Rodrigo S. perguntou há 5 dias
1 resposta

Professor particular de Veterinária

Quer aprender Veterinária? No Profes você encontra o professor de veterinária particular perfeito para que você aprenda eficientemente, por meio de aulas ou até mesmo um curso online de veterinária.

Você é professor? No Profes você pode oferecer suas aulas, criando o seu perfil gratuitamente! Crie seu perfil de professor particular

Aulas de Reforço Escolar de Veterinária

Se você está na escola, na faculdade, ou fazendo qualquer tipo de curso, o Profes oferece aulas de reforço escolar de veterinária particular, para você alcançar todos os seus objetivos acadêmicos!

Aqui você encontra Reforço Escolar para todos os níveis e necessidades: Ensino Fundamental, Ensino Médio, Ensino Superior e cursos livres.