Biologia (genética)

A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada.               

3’ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’

Cleo S.
Cleo
perguntou há 27 minutos

Sabe a resposta?

Ganhe 10 pts por resposta de qualidade
Responder dúvida

Professores particulares de Veterinária

+ Ver todos
Encontre e contrate um professor particular para te ajudar nos estudos.
2 avaliações
Contagem / MG
Doutorado: Ciências Farmacêuticas (UFMG)
Veterinária - Biologia Molecular Veterinária - Ensino Fundamental Veterinária - Bioquímica celular Exercícios de Veterinária Veterinária Básica Curso superior em Veterinária Veterinária Pré-Vestibular
Leciono Ciências e Biologia para os ensinos Fundamental e Médio. Também tenho experiência com as disciplinas introdutórias da Graduação.
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Maria F. Whatsapp do professor Maria F. Ver WhatsApp
1ª aula demonstrativa
Responde em 2 h e 51 min
Lidiane está online
Linhares / ES
Especialização: Docência em Matemática e Práticas Pedagógicas (Universidade Cândido Mendes)
Veterinária - Orientação Veterinária - revisão e formatação de TCC Melhoramento Genético Animal Genética Veterinária Veterinária - Bioestatística
Doutorado na área de Estatística. Ótimo trabalho com aulas preparatórias para concursos, inclusive Raciocínio Lógico. Reforço de Matemática, E. Médio.
Oferece aulas online (sala profes)
R$ 60 / aula
Conversar Whatsapp do professor Lidiane G. Whatsapp do professor Lidiane G. Ver WhatsApp
1ª aula demonstrativa
Responde em 2 h e 6 min
13 avaliações
São Carlos / SP
Doutorado: Doutoranda em Biotecnologia (Universidade Federal de São Carlos)
Veterinária - Biologia Celular Imunologia Veterinária Patologia Animal Veterinária - Microbiologia Veterinária - Biologia Veterinária - Processos Biológicos Melhoramento Genético Animal
Venha aprender Biologia, Farmácia-Bioquímica, Enfermagem
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 50 / aula
Conversar Whatsapp do professor Taís T. Whatsapp do professor Taís T. Ver WhatsApp
1ª aula demonstrativa
Responde em 6 h e 28 min

Pergunte aos nossos professores

Você possui uma lista de exercícios ou Trabalho?

Se seu problema for dificuldade em uma lista de exercícios, revisão de teses e dissertações, correção de textos ou outros trabalhos, peça uma ajuda pelo Tarefas Profes.

Enviar Tarefa