Tira-dúvidas profes

Dúvidas de Veterinária

Com o tira-dúvidas do Profes você pode enviar uma dúvida por mês gratuitamente. Migre de plano para enviar dúvidas ilimitadas. Nossos professores particulares estão aqui para te ajudar.

Biologia (genética)
A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada.                3’ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’...
Cleo S. Cleo S. perguntou há 2 dias
1 resposta
Biologia
A partir da sequência da fita molde de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada. 3’ ACTGTTTTACTGTTTCCCCAAATTAAAGATTTTA 5’...
Anita S. Anita S. perguntou há 3 dias
1 resposta
Me ajuda
A partir da sequência da fita codificante de DNA abaixo, de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada. 5’ TTTATGAAGTGTTATTGATCGATA 3’...
Mel L. Mel L. perguntou há 3 dias
1 resposta
Me ajudem
file:///C:/Users/Marcelo/Downloads/exercicio.pdf me ajuda nesses exercícios...
Rodrigo S. Rodrigo S. perguntou há 3 dias
1 resposta
Duvida
A partir da sequência da fita de RNA mensageiro de um organismo procarioto, diga qual será a provável sequência de aminoácidos codificada.   5’ A C U G A U G G G G C U A U G G U A A 3’...
Luzia S. Luzia S. perguntou há 3 dias
1 resposta
Genética
A partir da sequência de aminoácidos abaixo, demonstre uma possível sequência de DNA (fita dupla) indicando a fita molde e o sentido de ambas as fitas.  Met-Ala-Asp-Met-His-Fen-Arg-Asn-Ser-Gli...
Gabriela S. Gabriela S. perguntou há 4 dias
1 resposta
Proteina queratina
quantos aminoacidos a queratina tem e quantos nitrogenios hidrogenios carbonos e etc ela tem...
Eliana P. Eliana P. perguntou há 6 meses
1 resposta
Qual o mais usual
Estudy group of Equine or Equine Study Group...
Natalia T. Natalia T. perguntou há 1 ano
3 respostas
Erva toxica
Meu irmão achou uma das vacas no pasto tonta e disse que ela comeu ervas toxicas, ele sangrou a vaca e depois o vaqueiro disse que podia comer a carne. minha dúvida é: essa carne está contaminada: faz...
Lucileia S. Lucileia S. perguntou há 1 ano
2 respostas
Aulas
Oii sou isabelli queria saber se tem aulas para crianças sobre medicina veterinária? ...
Isabelli S. Isabelli S. perguntou há 1 ano
3 respostas

Professores particulares de Veterinária

+ Ver todos
Encontre e contrate um professor particular para te ajudar nos estudos.

Pergunte aos nossos professores

Você possui uma lista de exercícios ou Trabalho?

Se seu problema for dificuldade em uma lista de exercícios, revisão de teses e dissertações, correção de textos ou outros trabalhos, peça uma ajuda pelo Tarefas Profes.

Enviar Tarefa

Ranking mensal

Miguel A.
Miguel A.
10 melhores respostas
7.700 pts
Samuel F.
Samuel F.
9 melhores respostas
1.490 pts
Arquimedes M.
Arquimedes M.
5 melhores respostas
780 pts
Lucas G.
Lucas G.
4 melhores respostas
1.470 pts
Cláudio C.
Cláudio C.
4 melhores respostas
480 pts