Você sabe o que é DNA?

Biologia DNA Celular Dúvida
Você sabe o que é DNA?
Camila da Silva
em 05 de Dezembro de 2014

             Todo mundo certamente já ouviu falar em DNA. Parece que esse termo se popularizou nos últimos anos e é usado de forma descriteriosa e até mesmo equivocada para diversas finalidades, muitas vezes sem o mínimo sentido, como no marketing de produtos ("shampoo com DNA vegetal"), etc. Muitas pessoas leigas podem ser levadas a pensar "Se tem DNA, deve ser bom".
Isso sempre me levou a um questionamento: será que as pessoas realmente sabem o que é o DNA?


             A sigla DNA vem do inglês e significa ácido desoxirribonucleico. O DNA é a maior macromolécula celular, tratando-se de um polímero de nucleotídeos. Os nucleotídeos, por sua vez, são formados por:

1. Um grupamento fosfato;
2. Uma base nitrogenada: guanina (G) , citosina (C), Adenina (A) ou Timina (T), sendo complementares C-G e A-T; e
3. Uma pentose (glicídio/açúcar): a desoxirribose (que dá nome ao DNA).



Fonte: Brasil Escola

Nucleotídeo (Fonte: Brasil Escola)



          Ou seja, primariamente o DNA nada mais é do que uma cadeia com enorme repetição de moléculas menores chamadas nucleotídeos.

          E como o DNA tem aquela forma espiral que sempre vemos em livros, anúncios e etc?
          A sua conformação tridimensional em forma de dupla hélice se dá justamente pela existência da complementariedade de bases através de ligações (ou pontes) de hidrogênio sofrida entre C-G e A-T. Uma longa fita de DNA é unida a outra fita complementar, sendo que as bases nitrogenadas ficam voltadas para o centro da hélice. O sentido de cada fita é invertido, sendo que uma delas (dita fita senso) começará pelo fosfato do primeiro nucleotídeo, terminando no açúcar do último (sentido 5'-3') e a outra fita (chamada anti-senso) começará pelo açúcar e terminará no fosfato (sentido 3'-5') .


Estrutura da dupla hélice do DNA (Fonte: http://www.facom.ufms.br/)

 


Muitas vezes, a sequência de DNA é representada por biólogos, bioquímicos ou bioinformatas mostrando apenas a sua sequência de bases, da seguinte maneira:

5' ... ATGCATCGATGCTTACGATGCTAGCATGCTA ... 3'

3' ... TACGTAGCTACGAATGCTACGATCGTACGAT ... 5'

 

       Agora pergunto por que tamanha importância para essa molécula gigante que contém tais repetições de nucleotídeos?
       Uma das primeiras funções descritas do DNA está justamente na importância da sua sequência, contendo informação necessária para produzir diversas proteínas no nosso corpo. Essas informações estão codificadas a cada três nucleotídeos (códon de bases) que ditam qual aminoácido (componente das proteínas) entrará na cadeia protéica. A tradução de códon de bases para aminoácido é o tão falado: Código Genético.


Código Genético (fonte: www.sobiologia.com.br)

 

         Este curto artigo teve como objetivo introduzir a estrutura química do DNA. Espero ter ajudado na sua compreensão. Qualquer dúvida ou sugestão para esse ou novos posts, deixem seus comentários!


Abraço,
Prof. Camila

 

Araraquara / SP

1 avaliação
Doutorado: Doutora em Ciências - Micro e Imunologia (Biologia) (Universidade Federal de São Paulo)
Olá! Dou aulas particulares desde 2006 em diversas matérias da área biológica: bioquímica, biologia celular, biologia molecular, química geral, química orgânica, imunologia, patologia, entre outras. Já lecionei também em cursinhos, cursos técnicos e universidades. Minhas grandes paixões são ciência e educação. Desenvolvo projetos de pesquisa na área de oncologia, trabalhando principalmente com Biologia Celular e Molecular e Bioquímica. Ofereço aulas online, em domicílio ou em alguns locais p ...
Auxílio em TCC de Biologia, Monografia de Biologia, Dissertação em Biologia, Biologia Molecular, Biologia Celular, Patologia, Imunologia
Oferece aulas online (sala profes)
Oferece aulas presenciais
R$ 56 / aula
Conversar
Cadastre-se ou faça o login para comentar nessa publicação.

Confira artigos similares

Confira mais artigos sobre educação

Ver todos os artigos

Encontre um professor particular

Busque, encontre e converse gratuitamente com professores particulares de todo o Brasil